|
Cytiva Europe
cy5 base labeled dutp Cy5 Base Labeled Dutp, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/Amersham+Cy5-dUTP/us11015220-3311-8-11 Average 99 stars, based on 1 article reviews
cy5 base labeled dutp - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Jena Bioscience
aminoallyl dutp cy5 Aminoallyl Dutp Cy5, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/Aminoallyl-dUTP-Cy5/pm37054691-30-26-27 Average 94 stars, based on 1 article reviews
aminoallyl dutp cy5 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Danaher Inc
cy5 dutp ![]() Cy5 Dutp, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/Cy5-dUTP/pmc00026493-102-11-13 Average 96 stars, based on 1 article reviews
cy5 dutp - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Jena Bioscience
aminoallyl dutp xx cy5 ![]() Aminoallyl Dutp Xx Cy5, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/Aminoallyl-dUTP-XX-Cy5/pmc09062634-220-78-79 Average 93 stars, based on 1 article reviews
aminoallyl dutp xx cy5 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Becton Dickinson
cy5-dutp ![]() Cy5 Dutp, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp/pmc00194569-377-13-8 Average 90 stars, based on 1 article reviews
cy5-dutp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NEN Life Science
cy5-dutp ![]() Cy5 Dutp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp/pmc02693577-43-5-6 Average 90 stars, based on 1 article reviews
cy5-dutp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Enzo Biochem
cy5.5-dutp ![]() Cy5.5 Dutp, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp/pmc06395690-250-30-31 Average 90 stars, based on 1 article reviews
cy5.5-dutp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
MATHESON
cy5 dutp ![]() Cy5 Dutp, supplied by MATHESON, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp/pmc11708911-92-30-10 Average 90 stars, based on 1 article reviews
cy5 dutp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
BioMicro Systems Inc
cy5-dutp-labeled reference cdna ![]() Cy5 Dutp Labeled Reference Cdna, supplied by BioMicro Systems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp+labeled+reference+cdna/pmc04626894-194-5-20 Average 90 stars, based on 1 article reviews
cy5-dutp-labeled reference cdna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Merck & Co
pe cy5 5 ![]() Pe Cy5 5, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp+labeled/pmc12775366-41-7-13 Average 86 stars, based on 1 article reviews
pe cy5 5 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
DUTSCHER DOMINIQUE
cy5-dutp ![]() Cy5 Dutp, supplied by DUTSCHER DOMINIQUE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp/pm23362347-73-8-9 Average 90 stars, based on 1 article reviews
cy5-dutp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
MicroMax Inc
cy5-dutp ![]() Cy5 Dutp, supplied by MicroMax Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cy5+dutp/cy5+dutp/pm21749425-41-25-28 Average 90 stars, based on 1 article reviews
cy5-dutp - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: In vitro cloning of complex mixtures of DNA on microbeads: Physical separation of differentially expressed cDNAs
doi:
Figure Lengend Snippet: Model system for two-color competitive hybridization. A 34-mer, ggagatttgataaagtttgatgtgtaatagaggg, was synthesized with a 3′ FAM or Cy5 label. The oligonucleotides were brought to final concentration of 14 μM in 30 μl. The two labeled oligonucleotides were combined in nine separate mixtures in ratios of 1:0, 8:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:8, and 0:1. Hybridization of each mixture to 100,000 microbeads bearing the complementary oligonucleotide was performed, and 10,000 microbeads from each of the mixtures were analyzed with a Coulter Elite Flow Cytometer using 488-nm and 633-nm lasers.
Article Snippet: Thirty-five rounds of linear amplification with either R110 dUTP (Perkin–Elmer) or
Techniques: Hybridization, Synthesized, Concentration Assay, Labeling, Flow Cytometry
Journal:
Article Title: In vitro cloning of complex mixtures of DNA on microbeads: Physical separation of differentially expressed cDNAs
doi:
Figure Lengend Snippet: A reference library of 2,000,000 microbeads was formed by mixing equal numbers of microbeads with attached cDNA derived from induced and noninduced THP-1 cells. Reference microbeads (100,000) were hybridized with 10 μg each of Cy5-labeled probe and R110-labeled probe, both derived from the same induced library to yield A. Microbeads (1,600,000) were hybridized with 10 μg of Cy5-labeled probe from the induced library and 10 μg of R110-labeled probe derived from the noninduced library to yield B.
Article Snippet: Thirty-five rounds of linear amplification with either R110 dUTP (Perkin–Elmer) or
Techniques: Derivative Assay, Labeling
Journal: Scientific Reports
Article Title: Investigation and validation of labelling loop mediated isothermal amplification (LAMP) products with different nucleotide modifications for various downstream analysis
doi: 10.1038/s41598-022-11320-7
Figure Lengend Snippet: LAMP dUTP-labelling strategies. In this study, direct and indirect labelling of LAMP amplicons is shown. ( A ) Via indirect labelling, 5-aminoallyl-dUTP was introduced into the LAMP products and Cyanine-5 NHS-ester was coupled in a subsequent reaction. ( B ) Using direct labelling, modifications were incorporated into LAMP products using Cy5-dUTP and biotin-dUTP without additional reactions. ( C ) Amplicons labelled directly or indirectly via modified nucleotides can be used in various applications like microarray technology, spectroscopic analysis or lateral flow based systems.
Article Snippet: 25 µl LAMP with Bst3.0 DNA Polymerase and reaction buffer (New England Biolabs; M0374S) was performed according to manufactures instructions (using a Bio - Rad CFX Real-Time PCR System) accept to the following changes: i) for all assays dimethyl sulfoxide (DMSO) was used with a final concentration of 7.5% (v/v) and the volume of DNA template per reaction was 1 µl; ii) for qLAMP assay 1 µl of 50 × SYBR green I (Invitrogen; S7563) was added; iii)
Techniques: Modification, Microarray
Journal: Scientific Reports
Article Title: Investigation and validation of labelling loop mediated isothermal amplification (LAMP) products with different nucleotide modifications for various downstream analysis
doi: 10.1038/s41598-022-11320-7
Figure Lengend Snippet: Influence of labelled nucleotides on amplification efficiency. Presented are SYBR green based qLAMP results for the observation of amplification efficiencies using varying Cy5-dTUP and DNA concentrations per LAMP reaction. Relative fluorescence intensity (rFI) corresponds to SYBR green used for qLAMP analysis and is set to the highest fluorescence value reached by positive control (no Cy5). ( A ) shows a Cy5-dUTP dilution series from 2.0E-01 mM to 4.0E-03 mM using constant DNA amounts of 4.2E + 00 ng cDNA including a positive control (no Cy5) and a no enzyme control (NEC). ( B ) shows representative amplification curves for three different Cy5-dUTP amounts (no Cy5; 3.0E-02 mM and 8.0E-02 mM) using lower start DNA concentrations for visualisation of Ct-value shift caused by Cy5 labelled nucleotides.
Article Snippet: 25 µl LAMP with Bst3.0 DNA Polymerase and reaction buffer (New England Biolabs; M0374S) was performed according to manufactures instructions (using a Bio - Rad CFX Real-Time PCR System) accept to the following changes: i) for all assays dimethyl sulfoxide (DMSO) was used with a final concentration of 7.5% (v/v) and the volume of DNA template per reaction was 1 µl; ii) for qLAMP assay 1 µl of 50 × SYBR green I (Invitrogen; S7563) was added; iii)
Techniques: Amplification, SYBR Green Assay, Fluorescence, Positive Control
Journal: Scientific Reports
Article Title: Investigation and validation of labelling loop mediated isothermal amplification (LAMP) products with different nucleotide modifications for various downstream analysis
doi: 10.1038/s41598-022-11320-7
Figure Lengend Snippet: Detection of Cy5-dUTP in LAMP amplicons. Incorporation of fluorescent-labelled nucleotides was analysed by fluorescent spectroscopy as well as fluorescent gel electrophoresis. ( A ) Fluorescent spectra with Cy5-dUTP dilution series used in endpoint LAMP (4.0E-03 mM to 2.0E-01 mM). NEC and no-Cy5 representing LAMP positive and negative control. Fluorescent intensities are normalized to a uniform amplicon concentration measured after purification of LAMP products. ( B ) Calibration line (black dots and line) for calculation of incorporated Cy5 molecules for all sample (coloured dots). Colour scheme is the same as shown in ( A ). ( C ) Common SYBR green based gel electrophoresis with samples shown in ( A ). ( D ) Same gel as shown in ( C ) recorded by a microarray scanner to detect Cy5 fluorescent LAMP products.
Article Snippet: 25 µl LAMP with Bst3.0 DNA Polymerase and reaction buffer (New England Biolabs; M0374S) was performed according to manufactures instructions (using a Bio - Rad CFX Real-Time PCR System) accept to the following changes: i) for all assays dimethyl sulfoxide (DMSO) was used with a final concentration of 7.5% (v/v) and the volume of DNA template per reaction was 1 µl; ii) for qLAMP assay 1 µl of 50 × SYBR green I (Invitrogen; S7563) was added; iii)
Techniques: Spectroscopy, Nucleic Acid Electrophoresis, Negative Control, Amplification, Concentration Assay, Purification, SYBR Green Assay, Microarray
Journal: Scientific Reports
Article Title: Investigation and validation of labelling loop mediated isothermal amplification (LAMP) products with different nucleotide modifications for various downstream analysis
doi: 10.1038/s41598-022-11320-7
Figure Lengend Snippet: Yield of Cy5-dUTP incorporation.
Article Snippet: 25 µl LAMP with Bst3.0 DNA Polymerase and reaction buffer (New England Biolabs; M0374S) was performed according to manufactures instructions (using a Bio - Rad CFX Real-Time PCR System) accept to the following changes: i) for all assays dimethyl sulfoxide (DMSO) was used with a final concentration of 7.5% (v/v) and the volume of DNA template per reaction was 1 µl; ii) for qLAMP assay 1 µl of 50 × SYBR green I (Invitrogen; S7563) was added; iii)
Techniques:
Journal: Scientific Reports
Article Title: Investigation and validation of labelling loop mediated isothermal amplification (LAMP) products with different nucleotide modifications for various downstream analysis
doi: 10.1038/s41598-022-11320-7
Figure Lengend Snippet: Microarray-based false-positive discrimination of Cy5-dUTP labelled Salmonella and E. coli samples. ( A ) A 60 min LAMP was performed to provoke false positive results. In addition, a 40 min LAMP was performed as a comparison. ( B ) Digestion with DNAse and RsaI produces smaller LAMP fragments. ( C ) Microarray analysis producing fluorescent signals after hybridization of digested and untreated Salmonella and control samples, is shown as graph and ( D ) false coloured display. The invA_x probes representing different Salmonella specific probes designed for the LAMP product. OXA48 and VIMP1 are unspecific control probes. (error bars depict standard deviation, n = 9).
Article Snippet: 25 µl LAMP with Bst3.0 DNA Polymerase and reaction buffer (New England Biolabs; M0374S) was performed according to manufactures instructions (using a Bio - Rad CFX Real-Time PCR System) accept to the following changes: i) for all assays dimethyl sulfoxide (DMSO) was used with a final concentration of 7.5% (v/v) and the volume of DNA template per reaction was 1 µl; ii) for qLAMP assay 1 µl of 50 × SYBR green I (Invitrogen; S7563) was added; iii)
Techniques: Microarray, Hybridization, Standard Deviation
Journal: Genetics
Article Title: A tale of two serines: the effects of histone H2A mutations S122A and S129A on chromosome nondisjunction in Saccharomyces cerevisiae
doi: 10.1093/genetics/iyae194
Figure Lengend Snippet: Example of CGH microarray from hta1 -S122A strain (SGK177-9). The strain was a diploid formed by a cross of haploids isogenic with W303 and S288c. DNA isolated from the euploid control haploid W303 was labeled with Cy3 dUTP and the DNA from the experimental sample was labeled with Cy5 dUTP, and these samples were hybridized in competition to microarrays containing oligonucleotides that cover the entire yeast genome (details in Materials and Methods ). The scanned microarray shows the ratio of hybridization for each chromosome. The red and green colors show significant relative increases and decreases of hybridization in the experimental sample vs the control sample. The light gray lines above each chromosome are log 2 transforms of the ratio with the baseline having a value of 0, the first line above the baseline indicating a value of 1 and so on. Thus, euploid chromosomes have a log 2 value of 0, trisomic chromosomes a log 2 value of 0.6, and tetrasomic chromosomes a value of 1. The data of isolate SGK177-9 show that the experimental strain is monosomic for chromosome VIII and trisomic for chromosomes III and X. “Spikes” of the red signal are telomere-associated sequences present in the diploid starting strain that are absent in the control strain.
Article Snippet: In brief, DNA from the control euploid strain W303-1A (
Techniques: Microarray, Isolation, Control, Labeling, Hybridization